GH733237

Overview
NameGH733237
Unique NameGH733237
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length144
Libraries
Library NameType
Citrus clementina pistils cDNA-AFLP librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
GH733237_ssr103 microsatellite GH733237_ssr103:103..120.
Properties
Property NameValue
Genbank descriptionU_15 Citrus clementina pistils cDNA-AFLP library Citrus clementina cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>GH733237 ID=GH733237|Name=GH733237|organism=Citrus clementina|type=EST|length=144bp
GACTGCGTACCAATTCACCATCAATGCCCGGCTGGAAGTCATCTCCAGTT
CCATCAATGCTTGGGAACCCCAATATCTCGTCTTCAAGTAGTACTGGAGC
TAAGCAGCAGCAGCAGCAGCAACAAATGTTACTCAGGACTCATC
back to top