GH733238

Overview
NameGH733238
Unique NameGH733238
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length153
Libraries
Library NameType
Citrus clementina pistils cDNA-AFLP librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig4180 contig Ccv1_Contig4180:590..742. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionU_16 Citrus clementina pistils cDNA-AFLP library Citrus clementina cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>GH733238 ID=GH733238|Name=GH733238|organism=Citrus clementina|type=EST|length=153bp
GACTGCGTACCAATTCACAAAAACTGAACTCACACAGTCAGTATCACTTA
TGGATTCACAATCCAGTAGGCATGTTGTTCAAGCCTTGGCACTTCCTAGG
CACTTGAGGATGTCGAGATCTGAAGCTGGAAACTACATTACTCAGGACTC
ATC
back to top