GH733240

Overview
NameGH733240
Unique NameGH733240
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length151
Libraries
Library NameType
Citrus clementina pistils cDNA-AFLP librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig12975 contig Ccv1_Contig12975:1572..1722. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionU_19 Citrus clementina pistils cDNA-AFLP library Citrus clementina cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>GH733240 ID=GH733240|Name=GH733240|organism=Citrus clementina|type=EST|length=151bp
TGACTGCGTACCAATTCACTGTGGTGATGAAGGATGCTCTTCGAGCTTTG
ATCAAACCAAGGGCTTGATTCAATTCAATTGAGGTGATGATACGTTAATT
TATTTTTATAATTTTTCATTAAATAATGTATAGGGTTTACGCAGGACTCA
T
back to top