GH733241

Overview
NameGH733241
Unique NameGH733241
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length212
Libraries
Library NameType
Citrus clementina pistils cDNA-AFLP librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig421 contig Ccv1_Contig421:18..229. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionU_20 Citrus clementina pistils cDNA-AFLP library Citrus clementina cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>GH733241 ID=GH733241|Name=GH733241|organism=Citrus clementina|type=EST|length=212bp
GTTAGTTTTACCCTACTGATGACTGCGTCGTAATAGTAATTCAACCTAGT
ACGAGAGGAACCGTTGATTCGCACAATTGCTCATCGCGCTTGGTTGAAAA
GCCAGTGGCGCGAAGCTACCGTGCGCTGGATTATGACTGAACGCCTCTAA
GTCAGAATCCGGGCTAGAGCGGCGGGTAGAATCCTTTGCAGACGACTTAC
TCAGGACTCATC
back to top