GH733242

Overview
NameGH733242
Unique NameGH733242
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length359
Libraries
Library NameType
Citrus clementina pistils cDNA-AFLP librarycdna_library
Properties
Property NameValue
Genbank descriptionU_21 Citrus clementina pistils cDNA-AFLP library Citrus clementina cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>GH733242 ID=GH733242|Name=GH733242|organism=Citrus clementina|type=EST|length=359bp
GACTGCGTACCAATTCAGGTGGAGGATTTGGTGAGGAACCAGTACTTGAA
TGAGTACGTAGATGGARTGTCCCCCGTCAGTGAGTCGCAATATGCACAGG
ATGAAGGAGTTGAAAGGGGTTTGGAACGAGAACAGCCGACTATCCAAGTT
ATAGCAGGAGGGCCAACATTGGCCGGGGATTCAAACAGGGCACGGAAGAA
CTATGGGAGATACGCCCTGACTAGCAAAGAAGTGCTTTTCAATTTGCCAG
CAGCCAAGAGGGCAAAAGTGCGGCAAGTTCCTATTATGTGGACAGAGGAC
GACGAAGAAAGCATTTTATACCCTCACGAGGATGCGCTGGTGATTACTCA
GGACTCATC
back to top