GH733244

Overview
NameGH733244
Unique NameGH733244
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length344
Libraries
Library NameType
Citrus clementina pistils cDNA-AFLP librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionU_23 Citrus clementina pistils cDNA-AFLP library Citrus clementina cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>GH733244 ID=GH733244|Name=GH733244|organism=Citrus clementina|type=EST|length=344bp
GATGAGTCCTGAGTAATGGGTTTCGGGAGACAGTGGCTGATGCGGGTTTG
GTGGATTTGGGGATGGAGGGCTACCAGTTCACTTAGGAGAGAGCTCGGGG
AACAAAATAGTGGGTTGAGGAGTGCCTTGATAGGGCTCTCACTAATACGA
CTTGGTGTAGCTTATTTCTGACGGCCAAGGTTCGGAGCTTGGAGGCATTA
TGCTCCGATCATCTACCAATTTTTCTGGTGCCAAATCCTTCGATTCCCAG
TCCTCGGCATAACCGTTTTCGGTTTGGCAATTTATGGATTCGTGAATCTG
AGTGCGAAAATATAATTGGCAGGAGCTAGAATTGGTACGCAGTC
back to top