GH733245

Overview
NameGH733245
Unique NameGH733245
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length158
Libraries
Library NameType
Citrus clementina pistils cDNA-AFLP librarycdna_library
Properties
Property NameValue
Genbank descriptionU_24 Citrus clementina pistils cDNA-AFLP library Citrus clementina cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>GH733245 ID=GH733245|Name=GH733245|organism=Citrus clementina|type=EST|length=158bp
GATGAGTCCTGAGTAAGTCAAACAATATGGATTCGTCCAAAAGGTCAAAG
CACGTCTCAAAGTGCCAAGGNAGGAAGTCGCAAGGAAAGACTCATTCGAG
TAGTTTGATTGGTTTGAAGATTCATGAGACTGCTTTTCACTAGAATTGGT
ACGCAGTC
back to top