GH733246

Overview
NameGH733246
Unique NameGH733246
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length163
Libraries
Library NameType
Citrus clementina pistils cDNA-AFLP librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig815 contig Ccv1_Contig815:503..664. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionU_25 Citrus clementina pistils cDNA-AFLP library Citrus clementina cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>GH733246 ID=GH733246|Name=GH733246|organism=Citrus clementina|type=EST|length=163bp
GACTGCGTACCAATTCTAAGGAAAGTGCTTGAAAACAACAGAGGGGATTA
CAAAAAAGCAAGCCCCCTCATTGTCTAAGAGNACTTTTTGCCTACAACTC
CTTGAAAGCACAAATCACACCCCCCTTCATTATTCACTTTTTGAAACTTA
CTCAGGACTCATC
back to top