GH733247

Overview
NameGH733247
Unique NameGH733247
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length102
Libraries
Library NameType
Citrus clementina pistils cDNA-AFLP librarycdna_library
Properties
Property NameValue
Genbank descriptionU_26 Citrus clementina pistils cDNA-AFLP library Citrus clementina cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>GH733247 ID=GH733247|Name=GH733247|organism=Citrus clementina|type=EST|length=102bp
TCTACCGGTTGGTGTTACTCAGGACTTCATCCAATACTAGTGAATTCCCC
GGCCCGCCCTGCAGGTCCCNCCCATTATGGGGAAGAACCTTCCCCAACCG
CC
back to top