GH733248

Overview
NameGH733248
Unique NameGH733248
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length217
Libraries
Library NameType
Citrus clementina pistils cDNA-AFLP librarycdna_library
Properties
Property NameValue
Genbank descriptionU_27 Citrus clementina pistils cDNA-AFLP library Citrus clementina cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>GH733248 ID=GH733248|Name=GH733248|organism=Citrus clementina|type=EST|length=217bp
TGTNTGGCCGGNCGTTGAAGAGCAAGCCTAGAGCCTTAGAAGGTGCGAAG
TAAATCCCAGAAAAGTATCAATGCGGGAAAGAAAGATGCGCCATTCTTAG
TTAGGGAGAGGGTATGTTCACATTGAGTATCCTCGTATGCTCAGTCGAGN
GNCAAACGTACCTATCCCCGACGTGGGTAACGCATCTACAAAACCATGGT
GTTACTCAGGACTCATC
back to top