GH733249

Overview
NameGH733249
Unique NameGH733249
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length139
Libraries
Library NameType
Citrus clementina pistils cDNA-AFLP librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionU_28 Citrus clementina pistils cDNA-AFLP library Citrus clementina cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>GH733249 ID=GH733249|Name=GH733249|organism=Citrus clementina|type=EST|length=139bp
GACTGCGTCTCAATTCACCTTCCACTGAAGTGAAAATGAATAAAGTTGAT
AGAAGAGAGGCTGCATTGATCAAGTTTAGACAGAAGAGGAAGGAGCGCTG
TTTTGACAAGAAGATTAGGTATGTTACTCAGGACTCATC
back to top