GH733250

Overview
NameGH733250
Unique NameGH733250
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length122
Libraries
Library NameType
Citrus clementina pistils cDNA-AFLP librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Ccv1_Contig5389 contig Ccv1_Contig5389:107..228. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionU_29 Citrus clementina pistils cDNA-AFLP library Citrus clementina cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>GH733250 ID=GH733250|Name=GH733250|organism=Citrus clementina|type=EST|length=122bp
AAAGAACGNCGACNGAGCCGATTATATTACGATAGGTGTCAAGTGGAAGT
GCAGTGATGTATGCAGCTGAGGCATCCTAACAGACCGGTNGACTTGAACC
TTGTTCCTACATGACCNGATCA
back to top