GH733251

Overview
NameGH733251
Unique NameGH733251
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length156
Libraries
Library NameType
Citrus clementina pistils cDNA-AFLP librarycdna_library
Properties
Property NameValue
Genbank descriptionU_34 Citrus clementina pistils cDNA-AFLP library Citrus clementina cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>GH733251 ID=GH733251|Name=GH733251|organism=Citrus clementina|type=EST|length=156bp
TACGGGTTTATATGTTTACCATNNGCAAGACGTGTAACCGATGCTTTCCT
TCGTTTCAAGCACTAGGTGGACACAGAGCGAGTCACAAGAAACCTAAGGT
AATAAATAATAACATTGAAGCAAGTAAGAAAGCCTTTGTGTTACTCAGGA
CTCATC
back to top