GH733254

Overview
NameGH733254
Unique NameGH733254
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length104
Libraries
Library NameType
Citrus clementina pistils cDNA-AFLP librarycdna_library
Properties
Property NameValue
Genbank descriptionU_38 Citrus clementina pistils cDNA-AFLP library Citrus clementina cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>GH733254 ID=GH733254|Name=GH733254|organism=Citrus clementina|type=EST|length=104bp
GATGAGTCCTGAGTAACTAGACATTTGGGTTTTGCCTAGAAACAGGTAAG
TACTTAGATTATTGTTTCTTTTGTTTTGTCTTACTCCTGAATTGGTACGC
AGTC
back to top