GH733259

Overview
NameGH733259
Unique NameGH733259
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length135
Libraries
Library NameType
Citrus clementina pistils cDNA-AFLP librarycdna_library
Properties
Property NameValue
Genbank descriptionU_46 Citrus clementina pistils cDNA-AFLP library Citrus clementina cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>GH733259 ID=GH733259|Name=GH733259|organism=Citrus clementina|type=EST|length=135bp
GACTGCGTACCAATTCGCCAATGTCTAGTTCCTAAAACACGANCATGCGA
AGCTTGCTAATGAAATTATTGGTGGAGGGNACCGTCTTTTATTTCATTTA
GTGTAATAATAGCGTTATGTTACTCAGGACTCATC
back to top