GH733260

Overview
NameGH733260
Unique NameGH733260
TypeEST
OrganismCitrus clementina (Clementine)
Sequence length138
Libraries
Library NameType
Citrus clementina pistils cDNA-AFLP librarycdna_library
Properties
Property NameValue
Genbank descriptionU_47 Citrus clementina pistils cDNA-AFLP library Citrus clementina cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>GH733260 ID=GH733260|Name=GH733260|organism=Citrus clementina|type=EST|length=138bp
GATGAGTCCTGAGTAACACCAGGTCCAAAGCGGGGGAAGAAGAAGGCCTC
GAAATCCAAGGCAGGAACATCAACAGCGAGCAACAACCCTTCCGACGATT
ACTTGTTGTTCGCATCGCCCGCGAATTGGTACGCAGTC
back to top