BQ623114

Overview
NameBQ623114
Unique NameBQ623114
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length517
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig6056 contig Csv1_Contig6056:743..1258. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_00205 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00205 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623114 ID=BQ623114|Name=BQ623114|organism=Citrus sinensis|type=EST|length=517bp
AAAACGACGACGCAACGACTGATCTGAGGAGGATTCTGAAGCTTGACTTG
TTGTGAAGTTGGAAGTGAAAAGTGAAATAAAAGTTTCGTGGGCTTTGTTT
GTTTTTTAGTTTGGGGTCTTCTGATTAACGATCTTATCCCTTATTTTTTC
AAGGGGATGATGAAGATCGAATTGGCTGACTCCAACCTGGGTACTGACTA
GTGTTTAGCTTTAAGCTGTAATAGCAGTAGTAGTGTTAATTTAGAATTTT
AATGTATAGTTTTAAATTAGGGTTCAGCTCTGGGATATTGATAGGTGGTC
TTGTTCTTCTTTAAGTTTGGTGTACTTTGGTGGTTTTATTGTTTTTTTTT
TCAAGTCTTATGTTTATTTTAATTAACATGTCATATGATGAAATTATAGG
TATTATATGTCTGTGATTTTATTATTATCCTGTTGGGGGTTACTGGTTTG
TACCTCTCTTTGATGGGGTACATAGCTGACTTGCTTTGCTCTCCTATAAA
ATTTATGTTAATCAGTG
back to top