BQ623116

Overview
NameBQ623116
Unique NameBQ623116
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length368
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig6449 contig Csv1_Contig6449:262..629. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUSDA-FP_00207 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00207 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623116 ID=BQ623116|Name=BQ623116|organism=Citrus sinensis|type=EST|length=368bp
AGTTTACACGTCCCCACCACATCACCCTTACGTCTATGCATCTCCCCCTC
CTCCTCACCACTACTAGAAAGTGGCCACGAATAGCTCATGCTTTTTTATG
GAGAGGCGATTCGCATGCAAATAAAGAAAGCGACAGCTGATTAAGAGACT
TTACCGTGAGAAAAAGAAAAGCGAGTTGCCGCGTTTTAATTATCTTTATC
TTTTTTCCTTTTTGCCCCCCCAAGAGGAATAAATAGTTACATGTAGAAAA
GCAAAGTGCTTATCATTTTCATGTATGGATCGTTGCTGTGTGTAATTCGC
ATCTCACGTCTTTTGTAATTGTCAACCTTTTTGCATGCAGATGCAAGAGG
TTGGTCGTATAATAAAAT
back to top