BQ623119

Overview
NameBQ623119
Unique NameBQ623119
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length356
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3221 contig Csv1_Contig3221:332..686. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_00210 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00210 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623119 ID=BQ623119|Name=BQ623119|organism=Citrus sinensis|type=EST|length=356bp
GTGGGTCATTCACATCGAGCGCATCACTCGCGAGAAGGTTAATGGATCCA
CCTGTGAATGTGGGAATCAACCCATCAAAGGTCGTGATCACCAAGCTCCG
TCTGGACAAGGACAGGAAGTCTTTGCTCGATCGCAAGGCCAAGGGACGTG
CCGCCGCTGACAAGGAGAAGGGTACCAAGTTCACCCCAGAGGATATTATG
CAGAGTGTTGACTAATTTTTATAAGAGGTTGTTTTTAAAGTTTTTGTTTA
ATCATAGATTTTATGGATTTAGGATGTTTTGTTTTGGCAATGTCACTAAG
ATATTTCTATTGTTATTGTGTTATGCCATGAGGATCCGATTATGGGCTTA
TGTTGG
back to top