BQ623123

Overview
NameBQ623123
Unique NameBQ623123
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length358
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionUSDA-FP_00214 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00214 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623123 ID=BQ623123|Name=BQ623123|organism=Citrus sinensis|type=EST|length=358bp
GTCCAACGCTCAACACTTCAATGGAATTCAACAGGTAGCTGCCTGTGCAA
TTAATACACTCAAAGCTGCCTGTGCAAAAATTCTGAGAATATGCCACTGT
CGGACAAGTACATTAAACAGACTAATCGGCCTTGGAAAGATTTTAGCATT
GTTGTTCCTGGAAGTGAAATCCCAAAGTGGTTCGAGTATCAGAATAATGA
GGGTTCTTCAATAACAATAAGCACGCCTGCAAAGACGTATAAGAATAGTA
AGCTTGTGGGATATGCTGTGTGCTGTGTTTTTCGTATACCTAAATATTCA
CTTCCTAATTATACACATTGGGTTAAATACCCCGTACATTATCTGTGTGC
ACGGACTA
back to top