BQ623130

Overview
NameBQ623130
Unique NameBQ623130
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length370
Libraries
Library NameType
Ridge pineapple sweet orange entire seedlingcdna_library
Alignments
Feature NameTypeLocationAnalysis
BQ623130_ssr353 microsatellite BQ623130_ssr353:353..364.
Csv1_Contig92 contig Csv1_Contig92:972..1341. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUSDA-FP_00221 Ridge pineapple sweet orange entire seedling Citrus sinensis cDNA clone USDA-FP_00221 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>BQ623130 ID=BQ623130|Name=BQ623130|organism=Citrus sinensis|type=EST|length=370bp
GGCAACTTAATTGCTTTTGTGTTTTGGTTACGGTTACCATAAGCGAGTGG
AGATCTTTTTTTATTACCTTGAAGAACATGGAAACTCCTTGCGCAGGTAA
TAACAATTGGTTTGAGGGGGTCCCTCAAATGTGGCAGGCCGGTATTGGCG
ATGGGGAGAGTGTGAACGATAATCTCGATTTTCTTGTTATTCTTCACTAT
GGAAGAAATCTTGATTATACTGGTTAAGTGTACGAAGTATTAATCTTTTT
TATGTGTAATAAAATAAGAATCTGGATGTGTGTGTTAGTTTCAATATGTA
CTGTCTCTTTCTAAGTTTCAATATGTACTGTCTCTTTCTAAAACATAAAA
AGTAAATAAATAAAATTATT
back to top