CB304380

Overview
NameCB304380
Unique NameCB304380
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length424
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
CB304380_ssr47 microsatellite CB304380_ssr47:47..58.
Csv1_Contig92 contig Csv1_Contig92:958..1381. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIIaR_A04 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIIaR_A04 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304380 ID=CB304380|Name=CB304380|organism=Citrus sinensis|type=EST|length=424bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCTAACACACAATAATTTTA
TTTATTTACTTTTTATGTTTTAAAAAGAGACAGTACATATTGAAACTTAA
AAAGAGACAGTACATATTGAAACTAACACACACATCCAGATTCTTATTTT
ATTACACATAAAAAAGATTAATACTTCGTACACTTAACCAGTATAATCAA
GATTTCTTCCATAGTGAAGAATAACAAGAAAATCGAGATTATCGTTCACA
CTCTCCCCATCGCCAATACCGGCCTGCCACATTTGAGGGACCCCCTCAAA
CCAATTGTTATTACCTGCGCAAGGAGTTTCCATGTTCTTCAAGGTGATAA
AAGAAGATCTCCACTCGCTTATGGTAACCGTAACCAAAACACAAAAGCAA
TTAAGTTGCCTTAACGCATTTCCC
back to top