CB304381

Overview
NameCB304381
Unique NameCB304381
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length329
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIIaR_A06 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIIaR_A06 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304381 ID=CB304381|Name=CB304381|organism=Citrus sinensis|type=EST|length=329bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCTGCTTTTTTATTTTCTCTA
CACACTGGGGGGGGAGTCTTCCATCTCATCAGTTTTTTCACCAACAGTTG
ATAACGCATCATTAAATGCATTTGCACATTCTTCCTCCATAATCATTTCT
TTGATATCTTCACAATCATCAAATTGCTCAACTCCATCCTTTTCAGTTAA
AATGACAGCCTTTGTAGTCTCATTTGCATTTTGTTCTTTGTGATCTTCAG
CTTCCAACTGCGGTTCCTCTTTCTCCATTATTTCCTTATCATCTTCGTGA
TTTGATTTGTAGCTGCTGTTTTCTTCACC
back to top