CB304390

Overview
NameCB304390
Unique NameCB304390
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length499
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIIaR_B07 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIIaR_B07 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304390 ID=CB304390|Name=CB304390|organism=Citrus sinensis|type=EST|length=499bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGAATTCAAACCCATTATT
CATGTACACTTCTTTATTTCTTTTCGAGATATAAATCACAAAATAGAATA
CACACACTCATACAGTCATTCTCTCCTGCTATATCTGAATATAAATCACA
AAATAGATATATTCTCCTAGAATATAGGATGCACTGCCCCAAACGCACAC
ATACAAACCACAAAGATTATGTTATCAGTATTGAAGTTGACAAATTCTTT
TACCCTGCATCTCTTCACACAGAGAGTCAGTGCTCCAAATTCTACCAAAA
TGCTAATGTCATGACCCTTAGCGTAATCGGACCGGGGTCGTTTAAGCATG
CCACCAGAAGGGAGCAGAGAAGCCTGTTGACGATTCCAGTAACCGTCCGC
CATGATTATTATCTCTTGGCGTTGATTATTGGGATTTGCTAAAACCCTAG
GGCTCTTCCTCTGCTCTCTATTATTTTTCGCAATTCACACCACTTTCCC
back to top