CB304392

Overview
NameCB304392
Unique NameCB304392
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length469
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2573 contig Csv1_Contig2573:444..912. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIIaR_B09 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIIaR_B09 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304392 ID=CB304392|Name=CB304392|organism=Citrus sinensis|type=EST|length=469bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAATACAGAAAGAATAAGTA
TTATTATGTCATTAATAGTATGAAATATGAAAAGAACAAATAAATAATTC
AATACATTAATCTCCAATCACCCTCGAAAATAATATCCTAGTAATAGTTT
TCTTCCGTTACCAAACGACTTAGTGCTTCAGGAGAGCGAGAAGAGAAACA
AACAGCGAAGATGCAATAACAGCACCGGAAACCGGCAGAGAAGAGGCTGC
TCCGGTGTCCAATGAAGGAGATGGGGCGGGGGCCATCTCGGTGCTTTGAG
CTGAAGCAGCAGCCATTGCAAAAGCTGCCAAAACGAACACCATCACGACT
GACTTTAAGCTGCTAATTTGCCCCATCTGTGTTAATATTAATTGCTGAAG
AAAAACAAGAAGCAAGAACTATATGTGAAATCAAAGAATTGATTCAGTAA
TCAAGTTATTGGCAATCCC
back to top