CB304395

Overview
NameCB304395
Unique NameCB304395
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length407
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11142 contig Csv1_Contig11142:810..1216. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIIaR_B12 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIIaR_B12 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304395 ID=CB304395|Name=CB304395|organism=Citrus sinensis|type=EST|length=407bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTACAACTAAATCAAATTAATT
ACTTAAGTCTTTTACTATAAGAAATCAGAAAACTCAAATGTCATTAAATG
CTGTAATCCAAGATATCAAAATTTCCTAACCATAATAAGGAACCAAAAAT
TGTCACCTTGAAAAACATCCATGGGTCCCAGGAGTAATCCTATCATAAAG
TTGCAAATCAAGCAAACGTTAATATCTATCAAGTCCTCAAGAGTAAATCT
TTGGAATCTTATTGTAAACCTGGTCCATAAAAATATTGCCTTTGCCCCGA
TCACCTTCAACCATATGGATACTGTCAACAGCAGATTATCTGCATTCTCT
CTGAAGGTGTTCTGTTCATAAAACTGATGAGGCAAGGCAATTTGTTACCG
ATGACCC
back to top