CB304396

Overview
NameCB304396
Unique NameCB304396
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length377
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIIaR_C02 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIIaR_C02 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304396 ID=CB304396|Name=CB304396|organism=Citrus sinensis|type=EST|length=377bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTACCAGCTGGCCCTCTGAATGC
AATCCGACTCTCTATGAAAAATCTAACATATCTTGCATTCACCATTTGGT
CACTAAAACAAAATAAAACTGTTTGAACACCACTCGGCCAAGCTCCTACA
GGGCCTCCTGCTCGCTCCACAATCACGGTTGTTATATGCACCTTGAATCC
TTCACTATTGCTTGGAGTTGAAACTTATGTTTTATGACATGATATTAAGA
ATGAGACAGCCAATATAATCATGCTCTAACTAAAAACAGAGAGTTTGTTT
ATGAACTGAAGTTCTTAATGAGGCCACAAGACAAAATGTCATTTCCATTG
TAGATATAGTTAATTTTTTGGGATCCC
back to top