CB304399

Overview
NameCB304399
Unique NameCB304399
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length187
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIIaR_C07 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIIaR_C07 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304399 ID=CB304399|Name=CB304399|organism=Citrus sinensis|type=EST|length=187bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCATTGAAAGAAACACTTTA
ATAAATGCATAAAAGAAACAATTTCAGCATATATGAATTGAAAGGTCACT
ACTCGCTAACATTAATCATATAATCCATCAACAAGACAAACTCTGCTGAC
AAGATGTACTCAGAACAGGAACTAAAAATAATTTACC
back to top