CB304454

Overview
NameCB304454
Unique NameCB304454
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length135
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2009 contig Csv1_Contig2009:736..870. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIaR_A12 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIaR_A12 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304454 ID=CB304454|Name=CB304454|organism=Citrus sinensis|type=EST|length=135bp
TTTTNNNTTTTTTTTTTTTTTTTTTTTTTTCATAAAAGCTGGATTTTTCT
TTAATTATAACAACTAGATGTCTACCAGTAGACAGCCGTCAGCTTCCCCT
CCGGAATGCTAAAGACCGAACCGCAAACCAGTGAA
back to top