CB304458

Overview
NameCB304458
Unique NameCB304458
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length505
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIaR_B04 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIaR_B04 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304458 ID=CB304458|Name=CB304458|organism=Citrus sinensis|type=EST|length=505bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGAAACTCAGACAGAGAAAC
TTGACATTTTCTTATAGCATGATCAAGATCATTATGTACAGGGGGGAAAA
ACAAAAAACAGAGAAAGTAAGACAGAAAACTCATGCGTAATTAGGTTTCA
TCTACAAGCACAATTAATCACCGAGTAATTTTTTTAAAAAATTAATTTCT
TCAAGCCGAAAAGAAACCATCAAAGGCAGCAAGTGTAATCTGGCTCTTAG
GCTCCAATACCCACTTGACAAATTTTCTGATCTTGATCCCATCAGCCACG
ATCGAAACATTAACAACATCAGCAGTAGTAGCAGCAGCAGTAGCAGTAGC
AGGAGCAGCATTGTTATTTTGCTTGATAGTCATCTCTCTTTCAGCAGCCA
GTTTCCTTAAATTATTGACCCTCCTCTCATATTCTTCAGCAACCAGCATA
GCAATATCAGCCATGTCTCTTTTGAAATCAATTAACTTTTTTTATTTTTG
GTCCC
back to top