CB304459

Overview
NameCB304459
Unique NameCB304459
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length379
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
CB304459_ssr57 microsatellite CB304459_ssr57:57..68.
CB304459_ssr102 microsatellite CB304459_ssr102:102..117.
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIaR_B06 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIaR_B06 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304459 ID=CB304459|Name=CB304459|organism=Citrus sinensis|type=EST|length=379bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCAAATAACTAAATTTATTC
CTTTACAAATAAATAAATAAGATAATACGACTACTACATTTATACCTTTA
CAAATAAATAAATAAATGAGCTATAGCAATAATATAACTACTACATTTGA
TGAGATCATCATATGAGAATTAGACGGCTGTAGTATAATGCATCAAAGTG
ACATAACGCACCTAATTAAGGGTCAAAAAGCTCCTCATTACAAAAATATT
GGGCGGCTAATCAAAGCTCAGAAGGTTCCTCATATCAGAATTTAACAGAG
CAAAAATGAATTCTTGAAAACAAAACCTCTTCAAAACCCCTCACTCGCCT
TTCTTCACCGCAATCCGCAAGACACTTAC
back to top