CB304461

Overview
NameCB304461
Unique NameCB304461
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length157
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIaR_B08 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIaR_B08 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304461 ID=CB304461|Name=CB304461|organism=Citrus sinensis|type=EST|length=157bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGAATAAATATTTAAGTGAT
TGCAAATTTCCGAATTTCATTGTACATAGTGATGCTAGCATAAAAGCAGA
GATCACACATCCCATCGAACGTAGGGGGAATATCAAAAGGAGAAAAAAAA
AAAAAAA
back to top