CB304464

Overview
NameCB304464
Unique NameCB304464
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length332
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIaR_B12 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIaR_B12 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304464 ID=CB304464|Name=CB304464|organism=Citrus sinensis|type=EST|length=332bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCATAAAAGACAGTATTAACC
CTTTCTCTTAAGAAAGCATCGACTTCAGTTGCAAGAAATACAATGACAAA
ATCACAAACAAAACATTTCACAATCCTTACAACATCATTTTCGTTTCCAC
AGACAAGCGAGCTCCCTTGATTTGTGAATCTGTGAACTCTAAACACAATA
GGCATCTTTTTTGACTCCCCTCTTGTATCTTATCTTCTGTGAGTTAAAGA
ACGTTTGCTCTTTTTCTCTAGATATGCCTTTGTCTGGGTCTATCAAGTAT
CTCCAGACCCGTCACCGTATAGGATGATATTG
back to top