CB304465

Overview
NameCB304465
Unique NameCB304465
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length610
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIaR_C01 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIaR_C01 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304465 ID=CB304465|Name=CB304465|organism=Citrus sinensis|type=EST|length=610bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGAAATAATAGGCTTAATTA
TTAATATAAACCTCCCAATACAAATATTATAAATCACTCTTACATTTTGT
CACCACAACTCGTTTTTTAGCCTGGACTGCCAAACAGAAATCAGATTCTG
ACTTATTGACCCACAACACAATTTTGGCTTTACAAAACTGGAGATCAAGT
AGAGAGAGTCTCAGAAAACATTACAAGCGATTATTAGGGTATCAACAACC
TATAAATGGATCCCAAAAAATACAGCATTTTAACATTAAACTAAACAATG
ACAGCATGATTTTATTAATGGGAGAAGCTAATTCCTAATTCTACATTCTC
CATCACCATTAAAAATCGAATCAATCTGGTTGAACAATCACACCACAGAC
AATAACTTTTAAGTCGAAAAAGAAAAACACTACCCAACGCAGACTACCAC
CTCCCGTCACAGGCAATATGAACTGAATTCTTCTTAATGGAACACAACAG
GCCAAATAACCACCAAGCAAAGCATCCTCTTCTAGTCTGCTCTTGACTGA
CCAGCACGAGAAGAAAGAATGATACCAACAATAAGTCCATAAAGTGCCAG
CGCTTCAGCA
back to top