CB304470

Overview
NameCB304470
Unique NameCB304470
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length419
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2133 contig Csv1_Contig2133:697..1115. BLAST: Citrus Unigene V1 Contigs to Populus V2 proteins
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIaR_C07 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIaR_C07 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304470 ID=CB304470|Name=CB304470|organism=Citrus sinensis|type=EST|length=419bp
CCGGAACCCAAAGACTTTGATTTCTCATAAGGGGCCAGCGGAGTCCTAAA
AGTAACATCCGCTGATCCCTGGTCGGCATCGTTTATGGTTGAGACTAGGA
CGGTATCTGATCGTCTTCGAGCCCCCAACTTTCGTTCTTGATTAATGAAA
ACATCCTTGGCAAATGCTTTCGCAGTTGTTCGTCTTTCATAAATCCAAGA
ATTTCACCTCTGACTATGAAATACGAATGCCCCCGACTGTCCCTGTTAAT
CATTACTCCGATCCCGAAGGCCAACAGAATAGGACCGAAATCCTATGATG
TTATCCCATGCTAATGTATACAGAGCGTAGGCTTGCTTTGAGCACTCTAA
TTTCTTCAAAGTAACAGCGCCGGTGGCACGACCCGGCCAATTAAGGCCAG
GAGCGCATCACCGGCAGCC
back to top