CB304476

Overview
NameCB304476
Unique NameCB304476
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length581
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig346 contig Csv1_Contig346:1..581. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIaR_D01 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIaR_D01 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304476 ID=CB304476|Name=CB304476|organism=Citrus sinensis|type=EST|length=581bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGGGGACCAAAAAGTAGTTTC
TGATTCAATAATAAAGCTTACAAATATTGGACTTAAACAAAAAGATTAAC
CCCTTTTTCAACCGTACATATATTTATTGAAGGAAGAAAAGAAAGAAAAG
ACCCATAATCTACTTCGCCAAGCTAACAAAGAGATTAGTTAGATCCTAAT
CAAATTTCGGTTTCCTCCAACAAAACTAAGTTAAATATTGACTAAATCAG
TCTAGCTACTTAGGAGCACCGGTAGCACTGCTGCTTATCGATTTACTATT
TACCACATGTAAATACATGTGATCATAACTAGTTAAGTTACACACATAAC
AAGGAGTAAATGGAAAAAGAGCAATGTTTCCTTGGAACACTCTGAGGATT
TTCCGCTAGCTAGAGACTGCTCGTTTAATTTCCTCCAACTCCTCCTTCCC
ATTGGCTTTGAGTTAGGAGAATTTCGTCGGACGCGTACCATTAAATATGG
TTCTCAATTATTATCTAATTATAATTAAATAACTAACTAATACTTTAATT
AAGATCATGTCCAAAGAGCTGGTTCCCATAA
back to top