CB304477

Overview
NameCB304477
Unique NameCB304477
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length592
Libraries
Library NameType
Flavedo Maturecdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Alignments
Feature NameTypeLocationAnalysis
CB304477_ssr83 microsatellite CB304477_ssr83:83..92. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig4859 contig Csv1_Contig4859:1703..2295. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIaR_D02 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIaR_D02 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304477 ID=CB304477|Name=CB304477|organism=Citrus sinensis|type=EST|length=592bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGAAGCGGAGAAGGGTACAAA
TACAATAAAGCCATTATTTTCAGATTATTTACATATATATATGTACAACT
CTGTCTCCTAATCATGGACAGAATTTGTTTAGCAAAGTATCAGATTACAG
TCAACCTTGCCCACTTCATGTGAAAACACTGCCCTATTAGTTTAAATATC
AGTGTAATTCACATGATCTGCAATCTGTTAGTGTTTTAGGAGATACACCA
AACCTATCCAGGGGGAATTATCTGGCAGCTGCAGTTGCAGGAACCCCTTC
TCTGAAGATAATATTTGCAACTGGTGAGGGAAGCCAAGCTCCATTGCCAC
CAGCAGCCTGGCCATCCTGACAATTGTTGCCACCCCTCTTGGAATTCCCG
TGGCCCTTCTTCAGTCTACCACCCACGCTTCGTCCAACTAACCAGCCCAG
TTTCATGGCTGCAAATAAACCCAGTGCAATTGCAAGTGGTCTCACAGACC
AGTGGTAATCTCGATATGTTTATACTTCTCCACTACACCAGGACAAGTAT
CAAAAGAAACAAGTTCCACTTCGGATGGATCCGCCAAAGAGC
back to top