CB304478

Overview
NameCB304478
Unique NameCB304478
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length530
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10132 contig Csv1_Contig10132:77..606. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionFLAVEDO0001_IIaR_D03 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0001_IIaR_D03 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB304478 ID=CB304478|Name=CB304478|organism=Citrus sinensis|type=EST|length=530bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCGTAGGAAAAGAACAGCATT
TAAATATTACAAATCTAACACAGCTAGTTAAATTTGGAACTCAAAAAGGG
TGCACTTTGTTTATTATTTGCTGGCAAAGCAACTTACGTTCAATTAACCT
TGGGCATAAGCAGAGCCAATCTTTCTGAATCCGAAAACAAGGACAGAATC
TACTTCGTCCTCATTCAGCTGCCGTAAATTGATCCATGAACAAACGAGCT
TGAAGATTTCAAGAAACAAGACACAGGCCAGGATTGATAAAGCCGATGCC
AGGGAAACCACCGAAATTACGAAGTAACATCTCTGAACTGTTGCATACTG
CCGCCGGGAATTGATTCCGATCATCAACCCGCCAGATGCTGCGGCGAAGG
AGAGCATGACGGCGAAAACCAGGGCGTGAAACAGAGATGGGTGAGCTGCA
AAGAGGAAAGTCGGCACAGGACTTCCATTGACGTTTTGGTGAGGGAGAAA
CAAGATGAGTAAAGCGATTGCGAAGGAAAA
back to top