CB305032

Overview
NameCB305032
Unique NameCB305032
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length569
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1120 contig Csv1_Contig1120:144..712. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionFLAVEDO0003_IVaR_B04 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0003_IVaR_B04 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB305032 ID=CB305032|Name=CB305032|organism=Citrus sinensis|type=EST|length=569bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTAGAGTCTGAGAGGAAGC
TTCCCATTAGAAAAGCAGCAGTAACAGATACACTTAATGATTAATTAACT
AGCCATGGATCTGCAACAAACCCAGTTAAGGATTCGGAGAAGCAGCCATG
GCTGGTTTTTATTTTACAAACAAAAGCTCATAAAAAGACATCCAACAAAG
CCAACCACAAAAGACAAATAGTTCTTTTTATTGATACTACAATTTAAACG
ACCTCACAGCGCTGCTTATTATGGGGCATGTTCACGTCTCGTAATCTTCA
TTAACAGTTACAAGGGTTGCACTTGCAGTTTGGTCCACACTTGCAGCCGC
CCTCGGCTCCGAATCCCATCTCGGACCCCTCAGAGTGCATCTTGACAGGA
GCAACACCGAGGACGAGGGTCTCGGTGGCGACGGTGGTGCTCTCAAAGGA
TCTCAAGTCAGGGTACATGGCGCTACCGCCGCAGCCGCCGCCGCACTTGC
AGCTAGAACCACAGCCACAGTTTCCACCACAGCCAGACATTTTTTGTTTT
CCTTTGGTGATATAACGAT
back to top