CB305051

Overview
NameCB305051
Unique NameCB305051
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length465
Libraries
Library NameType
Flavedo Maturecdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2573 contig Csv1_Contig2573:444..908. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionFLAVEDO0003_IVaR_D06 Flavedo Mature Citrus sinensis cDNA clone FLAVEDO0003_IVaR_D06 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CB305051 ID=CB305051|Name=CB305051|organism=Citrus sinensis|type=EST|length=465bp
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTATTTTAAGAATAAGTATTAT
TATGTCATTAATAGTATGAAATATGAAAAGAACAAATAAATAATTCAATA
CATTAATCTCCAATCACCCTCGAAAATAATATCCTAGTAATAGTTTTCTT
CCGTTACCAAACGACTTAGTGCTTCAGGAGAGCGAGAAGAGAAACAAACA
GCGAAGATGCAATAACAGCACCGGAAACCGGCAGAGAAAAGGCTGCTCCG
GTGTCCAATGAAGGAGATGGTGCGGGGGCCATCTCGGTGCTTTGAGCTGA
AGCAGCAGCCATTGCAAAAGCTGCCAAAACGAACACCATCACGACTGACT
TTAAGCTGCTAATTTGCCCCATCTGTGTTAATATTAATTGCTGAAGAAAA
ACAAGAAGCAAGAACTATATGTGAAATCAAAGAATTGATTCAGTAATCAA
GTTATTGGCAATCCT
back to top