CF832026

Overview
NameCF832026
Unique NameCF832026
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length330
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12975 contig Csv1_Contig12975:1143..1472. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS02_01D02_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01D02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832026 ID=CF832026|Name=CF832026|organism=Citrus sinensis|type=EST|length=330bp
GAAATCGTTTGCCTTCCTGATTTGACCATTATGGGAACTCCTTGCGCAGG
TTATACCGATTGGTCGGAGGGGCTTATAGCCACAACTTTTTCACTTATTG
CTGATGATGAAATTAATGGAAATATTGATCTTCTTGTGGTCCCGCAATAT
GGAAGAAACCCTAATCACACTGGTTAAGAATATGCAGTATTAGTCTCTTA
TGTTATGTTTAAGAAAATAAAAGTATGGGTACTGTTATTACCCGTCAATT
GTATGATGGTCTCAATTTGGTTCAATTTAACTTGTAAGATCTCTTGATAT
ATATAAGAGATTCTCTTTGTCTAGCTAAAA
back to top