CF832031

Overview
NameCF832031
Unique NameCF832031
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length304
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13603 contig Csv1_Contig13603:1135..1438. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS02_01D05_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01D05, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832031 ID=CF832031|Name=CF832031|organism=Citrus sinensis|type=EST|length=304bp
CGCAATTCGTACGATGAATTCAGTGATGTTGATGATCATGATGATGATCT
GAGCCCTAAGAAGATGGGATATGAGAAGATGGCATATGAGAAGATTCCAT
CTAAGGAAGCTGCGTGAGGTGGTGTTTTATTCTAAATAATTAATTAAGCC
TAATATTTGTGTAATTGTGTACTGTGTTCTTATTTTCATTTGATGATTTC
ACTGCGTTTATAATGTGGATTATGATCATTATCATTCGAACAAAGTTCTG
CTTTGTGGTCTGTACTTATAAAGCTGTTATATGTCTCTAAAAAAAAAAAA
AAAA
back to top