CF832032

Overview
NameCF832032
Unique NameCF832032
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length302
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13603 contig Csv1_Contig13603:1136..1437. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS02_01D06_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01D06, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832032 ID=CF832032|Name=CF832032|organism=Citrus sinensis|type=EST|length=302bp
TTTTTTTTTTTTTTTAGAGACATATAACAGCTTTATAAGTACGGGCCACA
AAGCAGAACTTTGTTCGAATGATAATGATCATAATCCACATTATAAACGC
AGTGAAATCATCAAATGAAAATAAGAACACAGTACACAATTACACAAATA
TTAGGCTTAATTAATTATTTAGAATAAAACACCACCTCACGCAGCTTACT
TAGATGGAATCTTCTCATATGCCATCTTCTCATATCCCATCTTCTTAGGG
CTCAGATCATCATCATGATCATCAACATCACTGAATTCCTCATACGAATT
GC
back to top