CF832040

Overview
NameCF832040
Unique NameCF832040
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length350
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3439 contig Csv1_Contig3439:462..808. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS02_01D11_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01D11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832040 ID=CF832040|Name=CF832040|organism=Citrus sinensis|type=EST|length=350bp
TACACAATAGTTTTATTTATTAATTAAAGAACACTTTTACATGAACGCAA
ACAAAGATAATCTCTTGTATAAGACATTTTTGTAAGTGAACTGAACTAAA
TTGACACTCTTATAATTGATAGATAATAACTGTACCCATCTTTTTATTTA
ATTATATATATCATCATCCAGATTGCAGACACTTACCCATAATAATCAGG
ATTTCTCCCATATTGAGGAATAACAATAAGATCAAGATTGTCATTCCCAA
CATCATCATCAGCAATACTGGAAGGGGGGAGTAAGTAACCTTCTGACGGA
TCGCTCATACCTGCGCCAGGAAGAGTTTTCATATTCTTCAAGTCAGAAAA
back to top