CF832041

Overview
NameCF832041
Unique NameCF832041
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length367
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3439 contig Csv1_Contig3439:461..827. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS02_01D11_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01D11, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832041 ID=CF832041|Name=CF832041|organism=Citrus sinensis|type=EST|length=367bp
CTTTTCTGACTCGAATAATATGAAAACTCTTCCTGGCGCAGGTATGAGCG
ATCCGTCAGAAGGTTACTTACTCCCCCCTTCCAGTATTGCTGATGATGAT
GTTGGGAATGACAATCTTGATCTTATTGTTATTCCTCAATATGGGAGAAA
TCCTGATTATTATGGGTAAGTGTCTGCAATCTGGATGATGATATATATAA
TTAAATAAAAAGATGGGTACAGTTATTATCTATCAATTATAAGAGTGTCA
ATTTAGTTCAGTTCACTTACAAAAATCTCTTATACAAGAGATTATCTTTG
TTTGCGTTCATGTACTTTGTCTTCTTTAATTAATAAATAAAACTATTGTG
TAAAAAAAAAAAAAAAA
back to top