CF832042

Overview
NameCF832042
Unique NameCF832042
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length362
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
CF832042_ssr30 microsatellite CF832042_ssr30:30..41.
Csv1_Contig3439 contig Csv1_Contig3439:462..823. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS02_01D12_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01D12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832042 ID=CF832042|Name=CF832042|organism=Citrus sinensis|type=EST|length=362bp
TTTTTTTTTTTTTTACCATAGTTTTATTTATTAATTAATTAAGCCATAGT
ACATGAACGCAAACAAAGATAATCTCTTGTATAACAGATTTTTGTAAGTG
AACTGAACTAAATTGACACTCTTATAATTGATAGATAATAACTGTACCCA
TCTTTTTATTTAATTATATATATCATCATCCAGATTGCAGACACTTACCC
ATAATAATCAGGATTTCTCCCATATTGAGGAATAACAATAAGATCAAGAT
TGTCATTCCCAACATCATCATCAGCAATACTGGAAGGGGGGAGTAAGTAA
CCTTCTGACGGATCGCTCATACCTGCGCCAGGAAGAGTTTTCATATTCTT
CAAGTCAGAAAA
back to top