CF832043

Overview
NameCF832043
Unique NameCF832043
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length363
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3439 contig Csv1_Contig3439:465..827. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS02_01D12_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01D12, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832043 ID=CF832043|Name=CF832043|organism=Citrus sinensis|type=EST|length=363bp
TCTGACTCGAATAATATGAAAACTCTTCCTGGCGCAGGTATGAGCGATCC
GTCAGAAGGTTACTTACTCCCCCCTTCCAGTATTGCTGATGATGATGTTG
GGAATGACAATCTTGATCTTATTGTTATTCCTCAATATGGGAGAAATCCT
GATTATTATGGGTAAGTGTCTGCAATCTGGATGATGATATATATAATTAA
ATAAAAAGATGGGTACAGTTATTATCTATCAATTATAAGAGTGTCAATTT
AGTTCAGTTCACTTACAAAAATCTCTTATACAAGAGATTATCTTTGTTTG
CGTTCATGTACTTTGTCTTCTTTAATTAATAAATAAAACTATTGTGTAAA
AAAAAAAAAAAAA
back to top