CF832044

Overview
NameCF832044
Unique NameCF832044
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length130
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Properties
Property NameValue
Genbank descriptionUCRCS02_01D13_f Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa01D13, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF832044 ID=CF832044|Name=CF832044|organism=Citrus sinensis|type=EST|length=130bp
AAAACGTCTCCTGGAGAATAGAACTAACAGTATCATACGACTTCTTCAAC
TCTAATTCCATGACCACAACAGAACCTTTCTGTGCAACGGGAGACCAATC
CTTAGCTTGCACACCAATCCTCCAATCAAA
back to top