CF834755

Overview
NameCF834755
Unique NameCF834755
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length648
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1081 contig Csv1_Contig1081:1..648. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS02_06B02_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa06B02, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF834755 ID=CF834755|Name=CF834755|organism=Citrus sinensis|type=EST|length=648bp
TGCTTGTTCATCATTTAAAGCTCACAAAGNNATATTCCACAGCTTCCAAT
CGCCTATCAGCTTCATTAGTTGATGATGTTTGCAAAAAGAGTGATACTAC
TTATGGAGACTGTGTTTCAACTCTGGCATCCGATCCACGAACCCGAACCG
CATCGGATCTCAGATCTCTGGCAAGAATTGTTCTAGAGACAGCACACGCT
AACACAACAAAGAGCAAAGAACATTTTGAAATATTGGCAAAGAGCAGCAT
GACTGCACCAGATTTAATGGCCGCCCTAAAGAAATGTATCTTTGGTTATG
ATCGTGCAGCTGCATTATTCAGCTCTTCGAGAATGAAGATAGATTTGGAC
ATAACGGCAGCGAGTTACGATGCAATAGCTGCTCATGCTGGAGCCTTGTT
CTGTGCATATCAGTATAATTCCACCACTCGGATTGATGTTCAAACCATTA
GGGCGAGAAATATTTATCTGGAATCCTACGCTACTATTGCATTTGTTATT
ATCAATCAGCTTGGTGGCTGAATACGTTAACGTTTTGTTCAAATATTAAT
AATGCATAATAAAAATTATTTAATTATGTAAGGATCTTTGTTTCTTCTTC
TTGTTCAGTTGAGCGCCCTTTTAGTTTGATCCCGCCGTATCAGTTTTT
back to top