CF834765

Overview
NameCF834765
Unique NameCF834765
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length240
Libraries
Library NameType
Ruby Orange Ovary at Anthesis cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig13727 contig Csv1_Contig13727:341..580. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS02_06B08_r Ruby Orange Ovary at Anthesis cDNA Library Citrus sinensis cDNA clone CS_REa06B08, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CF834765 ID=CF834765|Name=CF834765|organism=Citrus sinensis|type=EST|length=240bp
CGTTAAGAGTAGGGCCCCTGGAGGTGGAGAGAAGAAGAAGCCTTGCATAA
CTTTGCTAGATGTCTTGTTCACCTGAACTTGGGTTATTAAATTTAGCACA
GTGTTTTAGCCTATGTTGTTTGCCTTTTTTTCCCCTTCATTTCAAAAACT
GAGGTAAAGATGTCAATTTGAGTGCTACAATGACCTTTACCTTTTTCCAG
AGAAAAATTTAATTGTTTTTTGTTAAAAAAAAAAAAAAAA
back to top